Review





Similar Products

97
New England Biolabs primer antisense mix
Primer Antisense Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer antisense mix/product/New England Biolabs
Average 97 stars, based on 1 article reviews
primer antisense mix - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

96
Thermo Fisher antisense primer
Antisense Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antisense primer/product/Thermo Fisher
Average 96 stars, based on 1 article reviews
antisense primer - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

90
PEQLAB pcr antisense primer #1428
Pcr Antisense Primer #1428, supplied by PEQLAB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr antisense primer #1428/product/PEQLAB
Average 90 stars, based on 1 article reviews
pcr antisense primer #1428 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sangon Biotech antisense-primer
Antisense Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antisense-primer/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
antisense-primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher assay (20x) containing sense antisense primers taqman® probes
Assay (20x) Containing Sense Antisense Primers Taqman® Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/assay (20x) containing sense antisense primers taqman® probes/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
assay (20x) containing sense antisense primers taqman® probes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
TaKaRa antisense primer
Antisense Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antisense primer/product/TaKaRa
Average 96 stars, based on 1 article reviews
antisense primer - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
New England Biolabs car r2 antisense primer
Car R2 Antisense Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/car r2 antisense primer/product/New England Biolabs
Average 96 stars, based on 1 article reviews
car r2 antisense primer - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

90
Metabion International AG egr1 antisense primer
The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples
Egr1 Antisense Primer, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/egr1 antisense primer/product/Metabion International AG
Average 90 stars, based on 1 article reviews
egr1 antisense primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing

The expression and diagnosis significance of IFI16, EGR1 and MX1 in LN. ( A ) IFI16 expression was distinctly upregulated in LN samples; ( C ) EGR1 expression was distinctly downregulated in LN samples; ( E ) MX1 expression was distinctly upregulated in LN samples. ( B / D / F ) Receiver operating characteristic (ROC) curves for IFI16, EGR1 and MX1 in LN. Normal samples n=35, LN samples n=91.

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: The expression and diagnosis significance of IFI16, EGR1 and MX1 in LN. ( A ) IFI16 expression was distinctly upregulated in LN samples; ( C ) EGR1 expression was distinctly downregulated in LN samples; ( E ) MX1 expression was distinctly upregulated in LN samples. ( B / D / F ) Receiver operating characteristic (ROC) curves for IFI16, EGR1 and MX1 in LN. Normal samples n=35, LN samples n=91.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Biomarker Discovery

Immune cell infiltration analysis of lupus nephrities. ( A ) Violin diagram of 22 types of immune cells between normal and LN specimens. Correlation of core genes IFI16 ( B ), EGR1 ( C ), MX1 ( D ) with infiltrating immune cells; the vertical ordinate represents the name of the immune cell and the abscissa represents the correlation coefficient; the circle size represents the absolute value size of the correlation coefficient.

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Immune cell infiltration analysis of lupus nephrities. ( A ) Violin diagram of 22 types of immune cells between normal and LN specimens. Correlation of core genes IFI16 ( B ), EGR1 ( C ), MX1 ( D ) with infiltrating immune cells; the vertical ordinate represents the name of the immune cell and the abscissa represents the correlation coefficient; the circle size represents the absolute value size of the correlation coefficient.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques:

Renal pathology and expression of IFI204, EGR1 and MX1 in tubular epithelial cells in LN. ( A ) HE staining of control mice kidney tissue sections. ( B ) HE staining of MRL/lpr mice kidney tissue sections. ( C ) The protein of IFI204, EGR1 and MX1 levels were examined in protein extracts from tubular epithelial cells of MRL/lpr or C57BL/6 mice, and ( D-F ) RT-qPCR for the levels of mRNA levels of EGR1, MX1 and IFI204 of tubular epithelial cells isolated from MRL/lpr or C57BL/6 mice. All data were shown as mean ± SD.

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Renal pathology and expression of IFI204, EGR1 and MX1 in tubular epithelial cells in LN. ( A ) HE staining of control mice kidney tissue sections. ( B ) HE staining of MRL/lpr mice kidney tissue sections. ( C ) The protein of IFI204, EGR1 and MX1 levels were examined in protein extracts from tubular epithelial cells of MRL/lpr or C57BL/6 mice, and ( D-F ) RT-qPCR for the levels of mRNA levels of EGR1, MX1 and IFI204 of tubular epithelial cells isolated from MRL/lpr or C57BL/6 mice. All data were shown as mean ± SD.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Staining, Control, Quantitative RT-PCR, Isolation

Expression of target protein in renal tubular with LN patients. Co-localisation of target proteins (pink) ( A) EGR1, ( B) IFI16 and ( C) MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Expression of target protein in renal tubular with LN patients. Co-localisation of target proteins (pink) ( A) EGR1, ( B) IFI16 and ( C) MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Marker, Staining

Expression of target protein in renal tubular within MRL/lpr. Co-localisation of target proteins (pink) ( A ) EGR1, ( B ): IFI204 and ( C ): MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Expression of target protein in renal tubular within MRL/lpr. Co-localisation of target proteins (pink) ( A ) EGR1, ( B ): IFI204 and ( C ): MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Marker, Staining